ORF ID ENST00000001146.7:3225:3318
Gene ID ENSG00000003137
Gene Type protein_coding
Gene Symbol CYP26B1
Genomic Location (Chrom: start-end; Strand) chr2:72130476 72130569 ; -
Orf Length (nt) 93
Transcript Length (nt) 4556
Upstream Length (nt) 3225
Orf Type dORF
Start Codon ATG
Phylocsf ENSG00000003137
Kozak Sequence and Score 3
Orf Length FDR 0.208
Nucleotide Sequence ATGAAGGACATGCCAGTCCCCGATCGCTGCTGTGAGCACCTCAGTGGCTCCCTCAGACCAGATCCCGTAGGCAGCCCCACAGACCGACCCTGA
Peptide Sequence MKDMPVPDRCCEHLSGSLRPDPVGSPTDRP
Pfam Domain N
TMHMM.2 Domain Y
Alphafold Predicted Structure N

Peptide cellular Location Predicted by Deeploc

Nucleus Cytoplasm Mitochondrion Golgi Apparatus Endoplasmic Reticulum Membrane Extracellular Cell Membrane LysosomeVacuole Peroxisome Plastid
0.0073 0.0134 0.0477 0 0 0.0026 0.9312 0 0 0 0.0004

TMHMM transmembrane helices Prediction

Domain Start End
inside 1 30

Description

  • Upstream Length: the distance between the transcript start site and the ORF start codon.
  • Start Codon: the start codon type.
  • Phylocsf: the averaged PhyloCSF score of the ORF sequence.
  • Kozak Score: the Kozak Score of sequence around the start codon.
  • Orf Length FDR: XXX
  • PepScore: the calculated PepScore.
  • Expression Level: the expression levels of translated ORFs across different samples (a link to show the Bar plot).
  • Peptide Location Prediction: the DeepLoc.1 predicted peptide cellular localization (a link to the prediction).
  • Pfam Domain: whether the peptide contains a Pfam domain, (Y: a link to the prediction; N: unavailable).
  • TMHMM.2 Domain: whether the peptide contains a TMHMM domain, (Y: a link to the prediction; N: unavailable).
  • Structure Prediction: whether a structure predicted by Alphafold, (Y: a link to the prediction; N: unavailable).
footer logo

Zhe Ji’s Lab

Feinberg School of Medicine

McCormick School of Engineering