ORF ID ENST00000001008.6:31:100
Gene ID ENSG00000004478
Gene Type protein_coding
Gene Symbol FKBP4
Genomic Location (Chrom: start-end; Strand) chr12:2794999 2795068 ; +
Orf Length (nt) 69
Transcript Length (nt) 3715
Upstream Length (nt) 31
Orf Type uORF
Start Codon GTG
Phylocsf ENSG00000004478
Kozak Sequence and Score 7
Orf Length FDR 0.317
Nucleotide Sequence GTGCTCAAGCCTCCTCGCGGTCCGCAGTCAGTGCCGCCGCGCCCGGCCTCCCGCACGCCCCGCAGGTAG
Peptide Sequence VLKPPRGPQSVPPRPASRTPRR
Pfam Domain N
TMHMM.2 Domain Y
Alphafold Predicted Structure Y

Peptide cellular Location Predicted by Deeploc

Nucleus Cytoplasm Mitochondrion Golgi Apparatus Endoplasmic Reticulum Membrane Extracellular Cell Membrane LysosomeVacuole Peroxisome Plastid
0.3511 0.0419 0.2122 0.0006 0.0002 0.132 0.1394 0.0249 0.0003 0 0.2294

TMHMM transmembrane helices Prediction

Domain Start End
outside 1 22

Structure Prediction

# Structure Start End
1

Description

  • Upstream Length: the distance between the transcript start site and the ORF start codon.
  • Start Codon: the start codon type.
  • Phylocsf: the averaged PhyloCSF score of the ORF sequence.
  • Kozak Score: the Kozak Score of sequence around the start codon.
  • Orf Length FDR: XXX
  • PepScore: the calculated PepScore.
  • Expression Level: the expression levels of translated ORFs across different samples (a link to show the Bar plot).
  • Peptide Location Prediction: the DeepLoc.1 predicted peptide cellular localization (a link to the prediction).
  • Pfam Domain: whether the peptide contains a Pfam domain, (Y: a link to the prediction; N: unavailable).
  • TMHMM.2 Domain: whether the peptide contains a TMHMM domain, (Y: a link to the prediction; N: unavailable).
  • Structure Prediction: whether a structure predicted by Alphafold, (Y: a link to the prediction; N: unavailable).
footer logo

Zhe Ji’s Lab

Feinberg School of Medicine

McCormick School of Engineering