ORF ID ENST00000003302.8:70:3304
Gene ID ENSG00000048028
Gene Type protein_coding
Gene Symbol USP28
Genomic Location (Chrom: start-end; Strand) chr11:113799239 113875501 ; -
Orf Length (nt) 3234
Transcript Length (nt) 4669
Upstream Length (nt) 70
Orf Type canonical
Start Codon ATG
Phylocsf ENSG00000048028
Kozak Sequence and Score 6
Orf Length FDR 0.001
Nucleotide Sequence ATGACTGCGGAGCTGCAGCAGGACGACGCGGCCGGCGCGGCAGACGGCCACGGCTCGAGCTGCCAAATGCTGTTAAATCAACTGAGAGAAATCACAGGCATTCAGGACCCTTCCTTTCTCCATGAAGCTCTGAAGGCCAGTAATGGTGACATTACTCAGGCAGTCAGCCTTCTCACTGATGAGAGAGTTAAGGAGCCCAGTCAAGACACTGTTGCTACAGAACCATCTGAAGTAGAGGGGAGTGCTGCCAACAAGGAAGTATTAGCAAAAGTTATAGACCTTACTCATGATAACAAAGATGATCTTCAGGCTGCCATTGCTTTGAGTCTACTGGAGTCTCCCAAAATTCAAGCTGATGGAAGAGATCTTAACAGGATGCATGAAGCAACCTCTGCAGAAACTAAACGCTCAAAGAGAAAACGCTGTGAAGTCTGGGGAGAAAACCCCAATCCCAATGACTGGAGGAGAGTTGATGGTTGGCCAGTTGGGCTGAAAAATGTTGGCAATACATGTTGGTTTAGTGCTGTTATTCAGTCTCTCTTTCAATTGCCTGAATTTCGAAGACTTGTTCTCAGTTATAGTCTGCCACAAAATGTACTTGAAAATTGTCGAAGTCATACAGAAAAGAGAAATATCATGTTTATGCAAGAGCTTCAGTATTTGTTTGCTCTAATGATGGGATCAAATAGAAAATTTGTAGACCCGTCTGCAGCCCTGGATCTATTAAAGGGAGCATTCCGATCATCTGAGGAACAGCAGCAAGATGTGAGTGAATTCACACACAAGCTCCTGGATTGGCTAGAGGACGCATTCCAGCTAGCTGTTAATGTTAACAGTCCCAGGAACAAATCTGAAAATCCAATGGTGCAGCTGTTCTATGGTACTTTCCTGACTGAAGGGGTTCGTGAAGGAAAACCCTTTTGTAACAATGAGACCTTCGGCCAGTATCCTCTTCAGGTAAACGGTTATCGCAACTTAGACGAGTGTTTGGAAGGGGCCATGGTGGAGGGTGATGTTGAGCTTCTTCCCTCCGATCACTCGGTGAAGTATGGACAAGAGCGTTGGTTTACAAAGCTACCTCCAGTGTTGACCTTTGAACTCTCAAGATTTGAGTTTAATCAGTCCCTTGGGCAGCCAGAGAAAATTCACAATAAGCTGGAATTTCCTCAGATTATTTATATGGACAGGTACATGTACAGGAGCAAGGAGCTTATTCGAAATAAGAGAGAGTGTATTCGAAAGTTGAAGGAGGAAATAAAAATTCTGCAGCAAAAATTGGAAAGGTATGTGAAATATGGCTCAGGCCCAGCTCGGTTCCCGCTCCCGGACATGCTGAAATATGTTATTGAATTTGCTAGTACAAAACCTGCCTCAGAAAGCTGTCCACCTGAAAGTGACACACATATGACATTACCACTTTCTTCAGTGCACTGCTCGGTTTCTGACCAGACATCCAAGGAAAGTACAAGTACAGAAAGCTCTTCTCAGGATGTTGAAAGTACCTTTTCTTCTCCTGAAGATTCTTTACCCAAGTCTAAACCACTGACATCTTCTCGGTCTTCCATGGAAATGCCTTCACAGCCAGCTCCACGAACAGTCACAGATGAGGAGATAAATTTTGTTAAGACCTGTCTTCAGAGATGGAGGAGTGAGATTGAACAAGATATACAAGATTTAAAGACTTGTATTGCAAGTACTACTCAGACTATTGAACAGATGTACTGCGATCCTCTCCTTCGTCAGGTGCCTTATCGCTTGCATGCAGTTCTTGTTCATGAAGGACAAGCAAATGCTGGACACTATTGGGCCTATATCTATAATCAACCCCGACAGAGCTGGCTCAAGTACAATGACATCTCTGTTACTGAATCTTCCTGGGAAGAAGTTGAAAGAGATTCCTATGGAGGCCTGAGAAATGTTAGTGCTTACTGTCTGATGTACATTAATGACAAACTACCCTACTTCAATGCAGAGGCAGCCCCAACTGAATCAGATCAAATGTCAGAAGTGGAAGCCCTATCTGTGGAACTCAAGCATTACATTCAGGAGGATAACTGGCGGTTTGAGCAGGAAGTAGAGGAGTGGGAAGAAGAGCAGTCTTGCAAAATCCCTCAAATGGAGTCCTCCACCAACTCCTCATCACAGGACTACTCTACATCACAAGAGCCTTCAGTAGCCTCTTCTCATGGGGTTCGCTGCTTGTCGTCTGAGCATGCTGTGATTGTAAAGGAGCAAACTGCCCAGGCTATTGCAAACACAGCCCGTGCCTATGAGAAGAGCGGTGTAGAAGCGGCACTGAGTGAGGTGATGCTGAGCCCTGCCATGCAAGGGGTCATCCTGGCCATAGCTAAAGCCCGTCAGACCTTTGACCGAGATGGGTCTGAAGCAGGGCTGATTAAGGCATTCCATGAAGAATACTCCAGGCTCTATCAGCTTGCCAAAGAGACCCCCACCTCTCACAGTGATCCTCGACTTCAGCATGTCCTTGTCTACTTTTTCCAAAATGAAGCACCCAAAAGGGTAGTAGAACGAACCCTTCTGGAACAGTTTGCAGATAAAAATCTTAGCTATGATGAAAGATCAATCAGCATTATGAAGGTGGCTCAAGCGAAACTGAAGGAAATTGGTCCAGATGACATGAATATGGAAGAGTACAAGAAGTGGCATGAAGATTATAGTTTGTTCCGAAAAGTGTCTGTGTATCTCCTAACAGGCCTAGAACTCTATCAAAAAGGAAAGTACCAAGAGGCACTTTCCTACCTGGTATATGCCTACCAGAGCAATGCTGCCCTGCTGATGAAGGGGCCCCGCCGGGGGGTCAAAGAATCCGTGATTGCTTTATACCGAAGAAAATGCCTTCTGGAGCTGAATGCCAAAGCAGCTTCTCTTTTTGAAACAAATGATGATCACTCCGTAACTGAGGGCATTAATGTGATGAATGAACTGATCATCCCCTGCATTCACCTTATCATTAATAATGACATTTCCAAGGATGATCTGGATGCCATTGAGGTCATGAGAAACCATTGGTGCTCTTACCTTGGGCAAGATATTGCAGAAAATCTGCAGCTGTGCCTAGGGGAGTTTCTACCCAGACTTCTAGATCCTTCTGCAGAAATCATCGTCTTGAAAGAGCCTCCAACTATTCGACCCAATTCTCCCTATGACCTATGTAGCCGATTTGCAGCTGTCATGGAGTCAATTCAGGGAGTTTCAACTGTGACAGTGAAATAA
Peptide Sequence MTAELQQDDAAGAADGHGSSCQMLLNQLREITGIQDPSFLHEALKASNGDITQAVSLLTDERVKEPSQDTVATEPSEVEGSAANKEVLAKVIDLTHDNKDDLQAAIALSLLESPKIQADGRDLNRMHEATSAETKRSKRKRCEVWGENPNPNDWRRVDGWPVGLKNVGNTCWFSAVIQSLFQLPEFRRLVLSYSLPQNVLENCRSHTEKRNIMFMQELQYLFALMMGSNRKFVDPSAALDLLKGAFRSSEEQQQDVSEFTHKLLDWLEDAFQLAVNVNSPRNKSENPMVQLFYGTFLTEGVREGKPFCNNETFGQYPLQVNGYRNLDECLEGAMVEGDVELLPSDHSVKYGQERWFTKLPPVLTFELSRFEFNQSLGQPEKIHNKLEFPQIIYMDRYMYRSKELIRNKRECIRKLKEEIKILQQKLERYVKYGSGPARFPLPDMLKYVIEFASTKPASESCPPESDTHMTLPLSSVHCSVSDQTSKESTSTESSSQDVESTFSSPEDSLPKSKPLTSSRSSMEMPSQPAPRTVTDEEINFVKTCLQRWRSEIEQDIQDLKTCIASTTQTIEQMYCDPLLRQVPYRLHAVLVHEGQANAGHYWAYIYNQPRQSWLKYNDISVTESSWEEVERDSYGGLRNVSAYCLMYINDKLPYFNAEAAPTESDQMSEVEALSVELKHYIQEDNWRFEQEVEEWEEEQSCKIPQMESSTNSSSQDYSTSQEPSVASSHGVRCLSSEHAVIVKEQTAQAIANTARAYEKSGVEAALSEVMLSPAMQGVILAIAKARQTFDRDGSEAGLIKAFHEEYSRLYQLAKETPTSHSDPRLQHVLVYFFQNEAPKRVVERTLLEQFADKNLSYDERSISIMKVAQAKLKEIGPDDMNMEEYKKWHEDYSLFRKVSVYLLTGLELYQKGKYQEALSYLVYAYQSNAALLMKGPRRGVKESVIALYRRKCLLELNAKAASLFETNDDHSVTEGINVMNELIIPCIHLIINNDISKDDLDAIEVMRNHWCSYLGQDIAENLQLCLGEFLPRLLDPSAEIIVLKEPPTIRPNSPYDLCSRFAAVMESIQGVSTVTVK
Pfam Domain N
TMHMM.2 Domain Y
Alphafold Predicted Structure N

Peptide cellular Location Predicted by Deeploc

Nucleus Cytoplasm Mitochondrion Golgi Apparatus Endoplasmic Reticulum Membrane Extracellular Cell Membrane LysosomeVacuole Peroxisome Plastid
0.7968 0.1943 0.0007 0.0018 0.0014 0.0787 0 0.0018 0.0007 0.0023 0.0003

TMHMM transmembrane helices Prediction

Domain Start End
outside 1 1077

Description

  • Upstream Length: the distance between the transcript start site and the ORF start codon.
  • Start Codon: the start codon type.
  • Phylocsf: the averaged PhyloCSF score of the ORF sequence.
  • Kozak Score: the Kozak Score of sequence around the start codon.
  • Orf Length FDR: XXX
  • PepScore: the calculated PepScore.
  • Expression Level: the expression levels of translated ORFs across different samples (a link to show the Bar plot).
  • Peptide Location Prediction: the DeepLoc.1 predicted peptide cellular localization (a link to the prediction).
  • Pfam Domain: whether the peptide contains a Pfam domain, (Y: a link to the prediction; N: unavailable).
  • TMHMM.2 Domain: whether the peptide contains a TMHMM domain, (Y: a link to the prediction; N: unavailable).
  • Structure Prediction: whether a structure predicted by Alphafold, (Y: a link to the prediction; N: unavailable).
footer logo

Zhe Ji’s Lab

Feinberg School of Medicine

McCormick School of Engineering