ORF ID ENST00000003100.13:114:1644
Gene ID ENSG00000001630
Gene Type protein_coding
Gene Symbol CYP51A1
Genomic Location (Chrom: start-end; Strand) chr7:92113664 92134364 ; -
Orf Length (nt) 1530
Transcript Length (nt) 3155
Upstream Length (nt) 114
Orf Type canonical
Start Codon ATG
Phylocsf ENSG00000001630
Kozak Sequence and Score 6
Orf Length FDR 0.001
Nucleotide Sequence ATGGCGGCGGCGGCTGGGATGCTGCTGCTGGGCTTGCTGCAGGCGGGTGGGTCGGTGCTGGGCCAGGCGATGGAGAAGGTGACAGGCGGCAACCTCTTGTCCATGCTGCTGATCGCCTGCGCCTTCACCCTCAGCCTGGTCTACCTGATCCGTCTGGCCGCCGGCCACCTGGTCCAGCTGCCCGCAGGGGTGAAAAGTCCTCCATACATTTTCTCCCCAATTCCATTCCTTGGGCATGCCATAGCATTTGGGAAAAGTCCAATTGAATTTCTAGAAAATGCATATGAGAAGTATGGACCTGTATTTAGTTTTACCATGGTAGGCAAGACATTTACTTACCTTCTGGGGAGTGATGCTGCTGCACTGCTTTTTAATAGTAAAAATGAAGACCTGAATGCAGAAGATGTCTACAGTCGCCTGACAACACCTGTGTTTGGGAAGGGAGTTGCATACGATGTGCCTAATCCAGTTTTCTTGGAGCAGAAGAAAATGTTAAAAAGTGGCCTTAACATAGCCCACTTTAAACAGCATGTTTCTATAATTGAAAAAGAAACAAAGGAATACTTTGAGAGTTGGGGAGAAAGTGGAGAAAAAAATGTGTTTGAAGCTCTTTCTGAGCTCATAATTTTAACAGCTAGCCATTGTTTGCATGGAAAGGAAATCAGAAGTCAACTCAATGAAAAGGTAGCACAGCTGTATGCAGATTTGGATGGAGGTTTCAGCCATGCAGCCTGGCTCTTACCAGGTTGGCTGCCTTTGCCTAGTTTCAGACGCAGGGACAGAGCTCATCGGGAAATCAAGGATATTTTCTATAAGGCAATCCAGAAACGCAGACAGTCTCAAGAAAAAATTGATGACATTCTCCAAACTTTACTAGATGCTACATACAAGGATGGGCGTCCTTTGACTGATGATGAAGTAGCAGGGATGCTTATTGGATTACTCTTGGCAGGGCAGCATACATCCTCAACTACTAGTGCTTGGATGGGCTTCTTTTTGGCCAGAGACAAAACACTTCAAAAAAAATGTTATTTAGAACAGAAAACAGTCTGTGGAGAGAATCTGCCTCCTTTAACTTATGACCAGCTCAAGGATCTAAATTTACTTGATCGCTGTATAAAAGAAACATTAAGACTTAGACCTCCTATAATGATCATGATGAGAATGGCCAGAACTCCTCAGACTGTGGCAGGGTATACCATTCCTCCAGGACATCAGGTGTGTGTTTCTCCCACTGTCAATCAAAGACTTAAAGACTCATGGGTAGAACGCCTGGACTTTAATCCTGATCGCTACTTACAGGATAACCCAGCATCAGGGGAAAAGTTTGCCTATGTGCCATTTGGAGCTGGGCGTCATCGTTGTATTGGGGAAAATTTTGCCTATGTTCAAATTAAGACAATTTGGTCCACTATGCTTCGTTTATATGAATTTGATCTCATTGATGGATACTTTCCCACTGTGAATTATACAACTATGATTCACACCCCTGAAAACCCAGTTATCCGTTACAAACGAAGATCAAAATGA
Peptide Sequence MAAAAGMLLLGLLQAGGSVLGQAMEKVTGGNLLSMLLIACAFTLSLVYLIRLAAGHLVQLPAGVKSPPYIFSPIPFLGHAIAFGKSPIEFLENAYEKYGPVFSFTMVGKTFTYLLGSDAAALLFNSKNEDLNAEDVYSRLTTPVFGKGVAYDVPNPVFLEQKKMLKSGLNIAHFKQHVSIIEKETKEYFESWGESGEKNVFEALSELIILTASHCLHGKEIRSQLNEKVAQLYADLDGGFSHAAWLLPGWLPLPSFRRRDRAHREIKDIFYKAIQKRRQSQEKIDDILQTLLDATYKDGRPLTDDEVAGMLIGLLLAGQHTSSTTSAWMGFFLARDKTLQKKCYLEQKTVCGENLPPLTYDQLKDLNLLDRCIKETLRLRPPIMIMMRMARTPQTVAGYTIPPGHQVCVSPTVNQRLKDSWVERLDFNPDRYLQDNPASGEKFAYVPFGAGRHRCIGENFAYVQIKTIWSTMLRLYEFDLIDGYFPTVNYTTMIHTPENPVIRYKRRSK
Pfam Domain N
TMHMM.2 Domain Y
Alphafold Predicted Structure N

Peptide cellular Location Predicted by Deeploc

Nucleus Cytoplasm Mitochondrion Golgi Apparatus Endoplasmic Reticulum Membrane Extracellular Cell Membrane LysosomeVacuole Peroxisome Plastid
0.0013 0.0014 0.0078 0.1018 0.7986 0.9338 0.0055 0.0452 0.034 0.0036 0.0009

TMHMM transmembrane helices Prediction

Domain Start End
outside 1 3
TMhelix 4 21
inside 22 27
TMhelix 28 50
outside 51 509

Description

  • Upstream Length: the distance between the transcript start site and the ORF start codon.
  • Start Codon: the start codon type.
  • Phylocsf: the averaged PhyloCSF score of the ORF sequence.
  • Kozak Score: the Kozak Score of sequence around the start codon.
  • Orf Length FDR: XXX
  • PepScore: the calculated PepScore.
  • Expression Level: the expression levels of translated ORFs across different samples (a link to show the Bar plot).
  • Peptide Location Prediction: the DeepLoc.1 predicted peptide cellular localization (a link to the prediction).
  • Pfam Domain: whether the peptide contains a Pfam domain, (Y: a link to the prediction; N: unavailable).
  • TMHMM.2 Domain: whether the peptide contains a TMHMM domain, (Y: a link to the prediction; N: unavailable).
  • Structure Prediction: whether a structure predicted by Alphafold, (Y: a link to the prediction; N: unavailable).
footer logo

Zhe Ji’s Lab

Feinberg School of Medicine

McCormick School of Engineering