ORF ID ENST00000002501.11:10:157
Gene ID ENSG00000003249
Gene Type protein_coding
Gene Symbol DBNDD1
Genomic Location (Chrom: start-end; Strand) chr16:90009420 90019447 ; -
Orf Length (nt) 147
Transcript Length (nt) 2056
Upstream Length (nt) 10
Orf Type ouORF
Start Codon ATG
Phylocsf ENSG00000003249
Kozak Sequence and Score 6
Orf Length FDR 0.08
Nucleotide Sequence ATGCGCTGCGCCCGGAGCCGGGGCCGAGTCGCTGCCGCAGCTGTTGGGGCGCCCGGGCCAGGCGACGCCGCCGTCGCCCGTGCCCCTCCCAGACCGCACCGGCCGCATGGAGCCCCCGGAGGGCGCCGGCACCGGAGAGATCGTTAA
Peptide Sequence MRCARSRGRVAAAAVGAPGPGDAAVARAPPRPHRPHGAPGGRRHRRDR
Pfam Domain N
TMHMM.2 Domain Y
Alphafold Predicted Structure Y

Peptide cellular Location Predicted by Deeploc

Nucleus Cytoplasm Mitochondrion Golgi Apparatus Endoplasmic Reticulum Membrane Extracellular Cell Membrane LysosomeVacuole Peroxisome Plastid
0.3846 0.047 0.4558 0.0001 0 0.0416 0.1057 0.0066 0 0 0.0001

TMHMM transmembrane helices Prediction

Domain Start End
inside 1 48

Structure Prediction

# Structure Start End
1 TurnI 19 22
2 310Helix 22 25
3 GammaInv 41 43

Description

  • Upstream Length: the distance between the transcript start site and the ORF start codon.
  • Start Codon: the start codon type.
  • Phylocsf: the averaged PhyloCSF score of the ORF sequence.
  • Kozak Score: the Kozak Score of sequence around the start codon.
  • Orf Length FDR: XXX
  • PepScore: the calculated PepScore.
  • Expression Level: the expression levels of translated ORFs across different samples (a link to show the Bar plot).
  • Peptide Location Prediction: the DeepLoc.1 predicted peptide cellular localization (a link to the prediction).
  • Pfam Domain: whether the peptide contains a Pfam domain, (Y: a link to the prediction; N: unavailable).
  • TMHMM.2 Domain: whether the peptide contains a TMHMM domain, (Y: a link to the prediction; N: unavailable).
  • Structure Prediction: whether a structure predicted by Alphafold, (Y: a link to the prediction; N: unavailable).
footer logo

Zhe Ji’s Lab

Feinberg School of Medicine

McCormick School of Engineering